circad | circRNAs associated with diseases

Circular RNA ARHGAP26
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	30719998
Experimental Method
Sample Type	Cell Lines	Comparison	Human GC cell lines including HGC-27, AGS, SGC-7901, BGC-823, NCI-N87 and human normal gastric mucosal cells GSE-1 were purchased
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AACAGACTCCATTGAGAAGAGGTT Reverse GCCTCCTGAAGCTGAGATTCTT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Wangxia, LV, Fang, Y, Liu, Y, Zhao, Y, Shi, Z, Zhong, H (2019). Circular RNA ARHGAP26 is over-expressed and its downregulation inhibits cell proliferation and promotes cell apoptosis in gastric cancer cells. Saudi J Gastroenterol, 25, 2:119-125.